rs12198812 chr6:41325588 T>C
- Sequence
aatgagacttaaaggaaataactt[T/C]cttttctctcctgtcctgcacatg
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 2.95 | n/a | 2.00 | 0.57 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hypertension (early onset hypertension), neuroblastoma (brain cancer), refractive error, stabilized warfarin dose, suicide attempts in bipolar disorder, suicide attempts in mood disorder patients, variant creutzfeldt-jakob disease