rs12200391 chr6:11494963 T>C
- Sequence
ccagccaagtaccctctaaagagt[T/C]gcagcaggcttgtcaccatagcta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.74 | 0.42 | 1.06 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -3.66 | 1.24 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood