rs12202510 chr6:71534152 C>A
- Sequence
taaattttgtcaggaattacagag[C/A]tactattattaataaaatatatta
- ASB in cell types
- bipolar neuron H929 (plasma cell myeloma) IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -1.23 | 1.23 | 1.00 | |||
| H929 (plasma cell myeloma) | 2.30 | -1.98 | 1.00 | |||
| IPSC-derived bipolar neuron | -0.59 | 1.39 | 1.00 |
Items per page:
1 – 3 of 3