rs12203386 chr6:161374316 T>G
- Sequence
gtggtatatgtggtgcgcgtgtgt[T/G]gtgtgtgtaacgcatggtgtgcat
- ASB in cell types
- foreskin keratinocyte LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.99 | -0.94 | 2.00 | |||
| LNCaP (prostate carcinoma) | -0.27 | 1.27 | 1.00 |
Items per page:
1 – 2 of 2