rs12203860 chr6:83464682 A>G
- Sequence
gtttgggaaacacaaaacagaaac[A/G]ttctagccaaatgggcagaggagg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.33 | 0.91 | 2.85 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, hypertension (early onset hypertension), ldl cholesterol, systolic blood pressure (sbp), total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Liver