rs12205834 chr6:72620315 A>T
- Sequence
cacctccacagtgcgtgggtgtga[A/T]gtgtattaggggaaagctagagag
- ASB in cell types
- BJ1-hTERT (Human fibroblast telomerase immortalized cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BJ1-hTERT (Human fibroblast telomerase immortalized cell line) | -1.31 | 1.90 | 1.00 |
Items per page:
1 – 1 of 1