rs12206438 chr6:133184978 A>G
- Sequence
tggaagtatatttcagggtacatt[A/G]tactttattgtgggtcaatagggg
- ASB in cell types
- K562 (myelogenous leukemia) thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 2.47 | -0.66 | 2.05 | |||
| thoracic aorta | 2.62 | -2.34 | 1.00 |
Items per page:
1 – 2 of 2