rs12206883 chr6:140587127 T>G
- Sequence
cagttcaaaagttgaaagatgaca[T/G]agccattttaagaaagaaccaaac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.79 | 0.41 | 1.12 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.94 | n/a | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Spinal_cord_cervical_c-1, Nerve_Tibial, Pituitary, Spleen, Testis, Thyroid, Whole_Blood