rs12207285 chr6:39981167 A>C
- Sequence
agtcactgagagaccaagcagaga[A/C]tgggacatttctgtcttttataga
- ASB in cell types
- K562 (myelogenous leukemia) GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.05 | 0.91 | 2.96 | |||
| GM17942 (lymphoblastoid cell) | -1.93 | 2.46 | 1.00 |
Items per page:
1 – 2 of 2