rs12209146 chr6:143642802 A>G
- Sequence
aaaccatcagaaactaggagaggg[A/G]catggaacagattctccctcacag
- ASB in cell types
- embryonic kidney 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| embryonic kidney | 2.67 | n/a | 2.00 | |||
| 22RV1 (prostate carcinoma) | 2.05 | 0.04 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial