rs12209186 chr6:100881405 C>T
- Sequence
cacgtcgactcgtcgactccgggc[C/T]ctctgccccgcccgcgtgcgcgcg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- VEZF1_HUMAN NELFE_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| VEZF1_HUMAN | 1.59 | -3.08 | 1.50 | -1.04 | Weak Concordant | |||
| NELFE_HUMAN | 1.97 | -4.28 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis