rs12209734 chr6:38872238 C>G
- Sequence
atggaacaactgctggttatagac[C/G]aacaagccaaaatcacagggaatc
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -0.39 | 0.49 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg