rs12210360 chr6:154170208 G>T
- Sequence
ttccttggaagaaagcttgggaaa[G/T]aaatacaatgagatttctttttcc
- ASB in cell types
- macrophages form periferal blood MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 1.82 | -0.98 | 2.00 | |||
| MDM(monocyte derived macrophages) | 1.52 | -0.45 | 2.33 |
Items per page:
1 – 2 of 2