rs12210437 chr6:149129948 C>T
- Sequence
gcggtggccgtatttgactcatgg[C/T]tttgggcacagatgtcatgtcatg
- ASB in cell types
- K562 (myelogenous leukemia) SU-DHL-1 (Anaplastic large cell lymphoma) tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | 0.60 | 1.06 | |||
| SU-DHL-1 (Anaplastic large cell lymphoma) | 1.63 | -4.00 | 2.00 | |||
| tibial nerve | -2.34 | 2.29 | 1.00 |
Items per page:
1 – 3 of 3