rs12212193 chr6:90287050 A>G
- Sequence
tacccagctctggaggtgacagtg[A/G]agtcctgcaagacagttccacaga
- ASB in cell types
- WA09 (embryonic stem cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.79 | 0.52 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, ldl cholesterol change with statins, multiple sclerosis, total cholesterol, triglycerides change with statins
PheWAS abnormal thyroid function, acquired hypothyroidism, anemia nos, aneurysm of artery of lower extremity, anomalies of jaw size/symmetry, benign neoplasm of brain and other parts of nervous system, benign neoplasm of other endocrine glands, bronchitis, cachexia, cardiomyopathy, cellulitis and abscess of trunk, cholelithiasis with other cholecystitis, chronic obstructive asthma with exacerbation, complex regional/central pain syndrome, complications of transplants and reattached limbs, cramp of limb, dermatomycoses, dermatophytosis of the body, elevated sedimentation rate, end stage renal disease, fracture of clavicle or scapula, gangrene, genital prolapse, gouty arthropathy, hemangioma and lymphangioma, any site, hemorrhage nos, hypersomnia, hypertrophy of female genital organs, hyperventilation, hypothyroidism, impaired fasting glucose, intestinal infection due to c. difficile, irritable bowel syndrome, joint/ligament sprain, lung disease due to external agents, meningitis, musculoskeletal symptoms referable to limbs, myopia, nasal polyps, noninflammatory disorders of vulva and perineum, nonrheumatic pulmonary valve disorders, nontoxic nodular goiter, nontoxic uninodular goiter, oral aphthae, osteomyelitis, other anemias, other disorders of adrenal glands, otorrhea, peptic ulcers, plasma protein metabolism disorder, postinflammatory pulmonary fibrosis, postmenopausal bleeding, protein plasma/amino-acid transport and metabolism disorder, sexually transmitted infections, sleep apnea, stomatitis and mucositis, symptoms involving female genital tract, syncope and collapse, thyrotoxicosis, tuberculosis