rs12212235 chr6:103273272 A>C
- Sequence
cctacagaataaccaaaggcattc[A/C]tgagtttgccatgtaccttcaact
- ASB in cell types
- foreskin keratinocyte GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.04 | -0.98 | 2.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 1.50 | -0.36 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, fasting insulin, ldl cholesterol change with statins, total cholesterol change with statins, years of education