rs12212773 chr6:154229984 A>G
- Sequence
caagcgatcagttatgactgtgtg[A/G]ttccatttctaggaagtgtccaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.66 | 0.97 | 1.07 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, childhood acute lymphoblastic leukemia, diastolic blood pressure (dbp), neuroblastoma (brain cancer), spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, systemic lupus erythematosus (sle), systolic blood pressure (sbp), triglycerides, years of education