rs12214374 chr6:67506746 T>A
- Sequence
tctattgcatcattgggtggcaaa[T/A]tttccaaacttctatgctctgctt
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | n/a | 4.04 | 2.00 | 2.35 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
