rs12215842 chr6:168903021 T>C
- Sequence
aaaagtagaaccttcctaccccca[T/C]tgaggacaggggcacctaacttcc
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.56 | -2.18 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, hdl cholesterol change with statins, neuroblastoma (brain cancer), salmonella-induced pyroptosis, sporadic creutzfeldt-jakob disease, total cholesterol, years of education