rs12215873 chr6:36916345 A>G
- Sequence
ctgtactcatatttttccctcttt[A/G]cccaccgcccacagttttcccacc
- ASB in cell types
- MDA-MB-157 (triple negative breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-157 (triple negative breast carcinoma) | 1.69 | -4.48 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Spleen, Thyroid, Whole_Blood