rs12216157 chr6:107704441 C>T
- Sequence
ctagacccctctagctgatggttt[C/T]ttcccaagtcgcaatctgtggtgc
- ASB in cell types
- prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| prostate gland | 2.33 | -2.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, eur students <30 digit span backward, height, ldl cholesterol change with statins, neuroblastoma (brain cancer), spine bone mineral density (bmd), urinary albumin-to-creatinine ratio