rs12216450 chr6:12269288 T>C
- Sequence
atatcatttgcagacagacacagt[T/C]tgacttcctctttttcaatttgaa
- ASB in cell types
- THP-1 (acute monocytic leukemia) monocyte-derived macrophages from peripheral blood CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.07 | 0.85 | 2.00 | |||
| monocyte-derived macrophages from peripheral blood | 1.82 | n/a | 2.50 | |||
| CD14+ monocytes | 1.49 | -0.55 | 2.00 |
Items per page:
1 – 3 of 3