rs12219105 chr10:77413782 T>C
- Sequence
gcttaagacatttgcactgattaa[T/C]tcacctagcagttactgtgtttgc
- ASB in cell types
- A1-2 (breast cancer cells) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- PRGR_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRGR_HUMAN | 0.08 | 1.79 | 1.68 | n/a | No Hit | |||
| GCR_HUMAN | -2.62 | 1.62 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence, alcohol dependence (early age of onset), alcohol dependence symptoms, comorbid depressive syndrome and alcohol dependence, hdl cholesterol