rs12219240 chr10:95291326 C>G
- Sequence
gtgctaggtgagagggaagcaggt[C/G]ctgacagcgagacaaactcgcgcc
- ASB in cell types
- primary B-CLL cells WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.42 | 0.17 | 3.00 | |||
| WA01 (H1, human embryonic stem cells) | -2.09 | 1.57 | 1.50 |
Items per page:
1 – 2 of 2