rs12219804 chr10:3668434 G>A
- Sequence
agttgcttttctggaatgcggaga[G/A]ttggagaatcagataaaagtcgag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.72 | 0.35 | 1.96 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP microalbuminuria, total cholesterol, total cholesterol change with statins, transmission distortion, triglycerides change with statins