rs12222235 chr11:132114436 C>T
- Sequence
ctgccttggttggattgcagttgg[C/T]aagttactttcagtgagggaagct
- ASB in cell types
- foreskin keratinocyte GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.20 | n/a | 2.67 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.79 | -0.12 | 1.17 |
Items per page:
1 – 2 of 2