rs12223477 chr11:76919241 T>C
- Sequence
ggttttatgtattcagccaaatgt[T/C]ggaaaaccgtttagattgtggagc
- ASB in cell types
- K562 (myelogenous leukemia) T47D (invasive ductal carcinoma) HCM (cardiac myocytes) hASC (preadipocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.75 | 0.15 | 1.98 | |||
| T47D (invasive ductal carcinoma) | 0.14 | 1.36 | 1.78 | |||
| HCM (cardiac myocytes) | 2.33 | -2.17 | 1.00 | |||
| hASC (preadipocytes) | 1.22 | 0.04 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, rheumatoid arthritis, combined control dataset, serum creatinine, total cholesterol change with statins
GTEx eQTL Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis