rs12223742 chr11:132114373 T>C
- Sequence
tcctcctccttaaatgtccctttc[T/C]gatcagccacgagagggcaatgca
- ASB in cell types
- tibial nerve HUES64 (embryonic stem cells)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | -0.78 | 1.75 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP late onset alzheimers disease, suicide attempts in major depressive disorder, total cholesterol