rs12224020 chr11:32154527 C>A
- Sequence
aggggtgattctgccccctaggga[C/A]acttggacatttctggagacagtt
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines) epithelial cell of prostate
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.88 | 0.48 | 1.17 | -1.21 | Weak Concordant | |||
| STAG1_HUMAN | 1.80 | -1.33 | 1.11 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid