rs12226536 chr11:120836050 C>G
- Sequence
gcagattcaagaatacccttatga[C/G]tctgccctgcactctgacagagtg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.57 | 1.89 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.95 | 0.89 | 1.03 |
Items per page:
1 – 2 of 2