rs12229630 chr12:47317320 G>A
- Sequence
tggttttggttttggttttgagac[G/A]gagtttcgctcttttgcccaggct
- ASB in cell types
- K562 (myelogenous leukemia) monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.08 | -0.12 | 2.00 | |||
| monocytes from periferal blood | 1.86 | -0.35 | 3.00 |
Items per page:
1 – 2 of 2