rs12229918 chr12:65368278 G>C
- Sequence
atatactattgattgttgatgtgt[G/C]atataaatccgactggagcatgcc
- ASB in cell types
- iPS-derived chondrocytes
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | -0.02 | 2.58 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI primary tooth development (number of teeth), primary tooth development (time to first tooth eruption)
GRASP adiponectin levels, body mass index (bmi), homa-b, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), major depressive disorder (narrow definition) (males), number of permanent teeth between ages 6 and 14 years old, waist hip ratio