rs12232865 chr19:54381716 A>C
- Sequence
taaaaaaaatttttcagccgggca[A/C]ggtggctcacgcctgtaatcccag
- ASB in cell types
- macrophages monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | 1.90 | -0.41 | 3.00 | |||
| monocytes from periferal blood | 2.01 | n/a | 3.00 |
Items per page:
1 – 2 of 2