rs12240483 chr10:6667881 C>T
- Sequence
aggatcatagctccccctcctggc[C/T]ctgtgcaatttgtaaatcctgctt
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.33 | -0.57 | 1.19 | -1.47 | Weak Concordant | |||
| STAG1_HUMAN | 1.55 | 0.23 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
