rs12240534 chr10:49110096 C>T
- Sequence
agcaacgatgcagcagctggcttc[C/T]agaactgaagtccagccccacccc
- ASB in cell types
- brain prefrontal cortex region tissues
- ASB for transcription factors
- OLIG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OLIG2_HUMAN | -1.02 | 1.92 | 1.00 | -1.69 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting insulin, hdl cholesterol, homa-b, homa-ir, triglycerides change with statins