rs12243192 chr10:123138744 T>C
- Sequence
ccaaaaatcagaactctgactatt[T/C]gaaacagctccatatctggcctgg
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) GM23248
- ASB for transcription factors
- EZH2_HUMAN SUZ12_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 1.05 | 1.29 | 1.00 | n/a | n/a | |||
| SUZ12_HUMAN | 0.20 | 2.03 | 1.10 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), infant head circumference