rs12244769 chr10:25935026 G>T
- Sequence
tgtcgcctcggagacctgtggcgc[G/T]cgcgggctttgcggcgccgcccac
- ASB in cell types
- foreskin keratinocyte GM12878 (female B-cells lymphoblastoid cell line) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.19 | -4.21 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.38 | 1.62 | 1.33 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 0.86 | 0.26 | 1.00 |
Items per page:
1 – 3 of 3