rs12245518 chr10:116743139 G>C
- Sequence
gggcaccgcctccaggccgcctgc[G/C]ggactccatggcaactccggaccc
- ASB in cell types
- upper lobe of left lung gastroesophageal sphincter adrenal gland transverse colon
- ASB for transcription factors
- CTCF_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.75 | -0.62 | 1.01 | 0.89 | Weak Discordant | |||
| CREB1_HUMAN | n/a | 2.19 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Pituitary, Spleen, Testis, Thyroid