rs12246440 chr10:125048307 C>T
- Sequence
agaggctgcagagacagccatgag[C/T]caccatcctcatttctatcccaac
- ASB in cell types
- HCT-116 (colon carcinoma) HCT-116-RAD21-mAC HeLa (cervical adenocarcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | -0.10 | 1.42 | 2.00 | |||
| HCT-116-RAD21-mAC | 0.05 | 1.70 | 2.00 | |||
| HeLa (cervical adenocarcinoma) | -3.21 | 0.88 | 2.00 | |||
| neural cell | 0.57 | -0.57 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.11 | 0.87 | 1.00 |
Items per page:
1 – 5 of 5