rs12247732 chr10:30757112 T>C
- Sequence
ttccccagaaatgaagaagttgcg[T/C]aacaacaaataaactactgtgaac
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma) SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -0.12 | 1.67 | 1.67 | 2.76 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, college completion, eye color, resistance to kuru in aged women despite likely exposure, waist hip ratio, years of education