rs12254134 chr10:119412370 C>A
- Sequence
tcgcctgggctgaccacgaggaca[C/A]cccggtgaagagctgggcgtgctt
- ASB in cell types
- HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- E2F8_HUMAN EPAS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| E2F8_HUMAN | 0.14 | 2.44 | 1.00 | n/a | No Hit | |||
| EPAS1_HUMAN | -0.06 | 1.82 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, alzheimers disease (apoe4 positive), aortic valve calcium, comorbid depressive syndrome and alcohol dependence, eye color, ldl cholesterol, nicotine dependence (smoking), rheumatoid arthritis, total cholesterol, treatment outcomes for selective serotonin reuptake inhibitors (ssris) - remission at 8 weeks, treatment outcomes for selective serotonin reuptake inhibitors (ssris) - remission at last visit, treatment outcomes for selective serotonin reuptake inhibitors (ssris) - remission at minimum 6 weeks, treatment outcomes for selective serotonin reuptake inhibitors (ssris) - response at minimum 6 weeks