rs12256435 chr10:92593521 G>T
- Sequence
ctgggccccctactgcgcggtcca[G/T]ggagagggattttatttgcatttc
- ASB in cell types
- adult erythroblasts
- ASB for transcription factors
- RBBP5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBBP5_HUMAN | 2.21 | -1.47 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), amyotrophic lateral sclerosis (als), college completion, eye color, ldl cholesterol, parkinsons disease, rheumatoid arthritis, schizophrenia, years of education