rs12258159 chr10:101095883 G>A
- Sequence
atgcctttgggaaggtgggaatcc[G/A]ccagcggagggtgatggggagtgg
- ASB in cell types
- FT282 (normal human fallopian tube tissue) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| FT282 (normal human fallopian tube tissue) | 1.79 | -1.03 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 2.74 | -5.07 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Small_Intestine_Terminal_Ileum