rs12261006 chr10:15088676 C>T
- Sequence
agccccacttaagcactcccctcg[C/T]ggagcgcccctcccgcgtggcctc
- ASB in cell types
- bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.06 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid