rs12264252 chr10:80517585 G>A
- Sequence
ctgttatttttggtttaacccagg[G/A]acaggcgtgtcctgccccatggct
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | n/a | 2.30 | 1.50 | 2.65 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP asthma, coronary artery disease (cad), fasting blood glucose, hdl cholesterol, total cholesterol
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood