rs12269159 chr10:9343123 A>T
- Sequence
ctgttttaactttgtgtatagaac[A/T]atcattgagctgtcaggctaaatt
- ASB in cell types
- Peyer's patch thoracic aorta foreskin keratinocyte KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 2.03 | -1.27 | 1.00 | |||
| thoracic aorta | -1.86 | 2.40 | 1.00 | |||
| foreskin keratinocyte | 0.96 | n/a | 2.33 | |||
| KMS-11 (Plasma cell myeloma) | -0.62 | 0.81 | 1.17 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd