rs12269712 chr10:127907879 G>A
- Sequence
cagcagccgccgggggtcggagat[G/A]cggcagggagaccctggcaggtgg
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.35 | 1.04 | 2.00 | 0.30 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
