rs12270466 chr11:71787545 C>G
- Sequence
aggccccgcccccgtcatggcgcc[C/G]gaggagaacgcggggagcgaactc
- ASB in cell types
- HCT-116 (colon carcinoma) GM01310 ( Transformed lymphovlasoid cell line ) BJ1-hTERT (Human fibroblast telomerase immortalized cell line) hMADS-3 (adipose-derived stem cells)
- ASB for transcription factors
- AHR_HUMAN MED26_HUMAN SP1_HUMAN EGR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AHR_HUMAN | 3.72 | n/a | 1.33 | n/a | No Hit | |||
| MED26_HUMAN | 2.82 | -2.59 | 1.00 | n/a | n/a | |||
| SP1_HUMAN | 2.32 | -1.43 | 1.00 | -0.20 | Weak Concordant | |||
| EGR1_HUMAN | 2.33 | -2.17 | 1.00 | n/a | No Hit | |||
| KLF11_HUMAN | 1.96 | n/a | 1.00 | -0.40 | Weak Concordant |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood