rs12279681 chr11:78645452 C>T
- Sequence
ccttggacccaggaagagctagtt[C/T]tgtttttgctgcaagaggctaggt
- ASB in cell types
- erythroid cells CD34+ stem cells-derived erythroblasts THP-1 (acute monocytic leukemia) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 4.13 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | -1.54 | 2.92 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.73 | 1.44 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -0.10 | 0.68 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | 1.33 | -0.87 | 1.00 |
Items per page:
1 – 5 of 9