rs12280753 chr11:116742944 C>T
- Sequence
taagtgtgtatagacccagggctc[C/T]gctttcgccagtctagaaaaggca
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.54 | 0.93 | 1.28 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), cystatin c in serum, hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, lp-pla2 activity, refractive error, total cholesterol, total cholesterol change with statins, triglycerides, triglycerides change with statins